This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004728


Marker Name:  ADL0201 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GCTGAGGATTCAGATAAGAC
Primer: AATGGCTGACGTTTCACAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01622
has an Associated Sequence: Local Sequence ID: ARKFSQ00003487

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Ben-Avraham, D. et al 2006 (M): Z Chicken
chromosome Z
97.560 97.560 97.560
Consensus 2000 (A): Z Chicken
chromosome Z
87.000 87.000 87.000
Consensus 2005 (A): Z Chicken
chromosome Z
86.000 87.000 88.000
East Lansing (M): Z Chicken
chromosome Z
97.560 97.560 97.560
ENSEMBL53 WASHUC2 Chicken Assembly: Z Chicken
chromosome Z
32173198.000 32173264.500 32173331.000
ENSEMBL71 Galgal4 Chick Assembly: Z Chicken
chromosome Z
32286738.000 32286804.500 32286871.000
Wageningen (A): Z Chicken
chromosome Z
94.100 94.100 94.100
Wageningen (M): Z Chicken
chromosome Z
94.100 94.100 94.100


© The Roslin Institute 2007-2012, all rights reserved