This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004726


Marker Name:  ADL0199 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 7910177

PCR Primers

Primer: GACGAAAGCAAGAGCAAAGC
Primer: ACAAAGCCAGAGGAAACATC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01620
has an Associated Sequence: Local Sequence ID: ARKFSQ00003485

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
East Lansing (M): 17 Chicken
chromosome 17
58.480 58.480 58.480
ENSEMBL53 WASHUC2 Chicken Assembly: 17 Chicken
chromosome 17
717544.000 717625.500 717707.000
ENSEMBL71 Galgal4 Chick Assembly: 17 Chicken
chromosome 17
337717.000 337798.500 337880.000


© The Roslin Institute 2007-2012, all rights reserved