This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004715


Marker Name:  ADL0188 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CACTTCCAGTATTAACGTGA
Primer: GTGGACACAATGAGTTCCTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01609
has an Associated Sequence: Local Sequence ID: ARKFSQ00003475

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
133.000 133.000 133.000
Consensus 2005 (A): 1 Chicken
chromosome 1
132.000 133.000 134.000
East Lansing (M): 1 Chicken
chromosome 1
126.550 126.550 126.550
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
48175152.000 48175227.500 48175303.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
46136001.000 46136076.500 46136152.000
Ikeobi, C.O.N. et al . 2004 (A): 1 Chicken
chromosome 1
102.900 102.900 102.900
Sewalem, A. et al . 2002 (A): 1 Chicken
chromosome 1
102.900 102.900 102.900
Wageningen (A): 1 Chicken
chromosome 1
98.800 98.800 98.800
Wageningen (F): 1 Chicken
chromosome 1
88.600 88.600 88.600
Wageningen (M): 1 Chicken
chromosome 1
115.100 115.100 115.100


© The Roslin Institute 2007-2012, all rights reserved