This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004710


Marker Name:  ADL0183 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TTGTGAAGTGGATAAGATGA
Primer: ACAGAAATGGAAAGCGAGAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01605
has an Associated Sequence: Local Sequence ID: ARKFSQ00003471

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
443.000 443.000 443.000
Consensus 2005 (A): 1 Chicken
chromosome 1
442.000 443.000 444.000
East Lansing (M): 1 Chicken
chromosome 1
411.290 411.290 411.290
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
156472083.000 156472133.500 156472184.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
151482096.000 151482146.500 151482197.000
Ikeobi, C.O.N. et al . 2002 (A): 1 Chicken
chromosome 1
403.500 403.500 403.500
Ikeobi, C.O.N. et al . 2004 (A): 1 Chicken
chromosome 1
403.500 403.500 403.500
Sewalem, A. et al . 2002 (A): 1 Chicken
chromosome 1
403.500 403.500 403.500
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
443.000 443.000 443.000
Wageningen (A): 1 Chicken
chromosome 1
411.500 411.500 411.500
Wageningen (F): 1 Chicken
chromosome 1
401.800 401.800 401.800
Wageningen (M): 1 Chicken
chromosome 1
430.800 430.800 430.800


© The Roslin Institute 2007-2012, all rights reserved