This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004687


Marker Name:  ADL0160 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TGGCAGAAATAAGGCAGTGC
Primer: ATTCATCGCTGGCATCTTGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01584
has an Associated Sequence: Local Sequence ID: ARKFSQ00003460

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
33.000 33.000 33.000
Consensus 2005 (A): 1 Chicken
chromosome 1
32.000 33.000 34.000
East Lansing (M): 1 Chicken
chromosome 1
27.660 27.660 27.660
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
5927129.000 5927189.500 5927250.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
5714745.000 5714805.500 5714866.000
Jennen et al. 2004 (A): 1 Chicken
chromosome 1
33.000 33.000 33.000
Kerje et al. 2003a (A): 1 Chicken
chromosome 1
0.000 0.000 0.000
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
0.000 0.000 0.000
Wageningen (A): 1 Chicken
chromosome 1
10.500 10.500 10.500
Wageningen (F): 1 Chicken
chromosome 1
6.600 6.600 6.600
Wageningen (M): 1 Chicken
chromosome 1
11.500 11.500 11.500


© The Roslin Institute 2007-2012, all rights reserved