This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004677


Marker Name:  ADL0150 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ATGCCAAGCATTACAGAAGC
Primer: CCTGCAGCACCTTTATCTCT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003445
has an Associated Sequence: Sequence Genbank ID: G01575

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
East Lansing (M): 1 Chicken
chromosome 1
189.820 189.820 189.820
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
67128733.000 67128810.500 67128888.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
65124714.000 65124791.500 65124869.000
Wageningen (A): 1 Chicken
chromosome 1
173.000 173.000 173.000
Wageningen (F): 1 Chicken
chromosome 1
165.000 165.000 165.000
Wageningen (M): 1 Chicken
chromosome 1
183.400 183.400 183.400


© The Roslin Institute 2007-2012, all rights reserved