This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004663


Marker Name:  ADL0136B 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 7910177

PCR Primers

Primer: TGTCAAGCCCATCGTATCAC
Primer: CCACCTCCTTCTCCTGTTCA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003435
has an Associated Sequence: Sequence Genbank ID: G01561
has an Associated Sequence: Local Sequence ID: ARKFSQ00003436

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
East Lansing (M): 4 Chicken
chromosome 4
127.840 127.840 127.840
ENSEMBL53 WASHUC2 Chicken Assembly: 9 Chicken
chromosome 9
19632284.000 19632349.500 19632415.000
ENSEMBL53 WASHUC2 Chicken Assembly: Un_random Chicken
chromosome
8634171.000 8634243.000 8634315.000
ENSEMBL71 Galgal4 Chick Assembly: 9 Chicken
chromosome 9
17713724.000 17713796.000 17713868.000


© The Roslin Institute 2007-2012, all rights reserved