This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004628


Marker Name:  ADL0101 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CCCCAAGGAGAACTGATTAC
Primer: GAAAAGTGAAAACGCAAACA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003421
has an Associated Sequence: Sequence Genbank ID: G01546

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
500.000 500.000 500.000
Consensus 2005 (A): 1 Chicken
chromosome 1
499.000 500.000 501.000
East Lansing (M): 1 Chicken
chromosome 1
454.670 454.670 454.670
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
181375655.000 181375740.000 181375825.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
176327963.000 176328048.000 176328133.000
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
500.000 500.000 500.000
Wageningen (A): 1 Chicken
chromosome 1
474.700 474.700 474.700
Wageningen (F): 1 Chicken
chromosome 1
474.800 474.800 474.800
Wageningen (M): 1 Chicken
chromosome 1
492.800 492.800 492.800


© The Roslin Institute 2007-2012, all rights reserved