This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004626


Marker Name:  ADL0043 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: TGAAGCAAAAACCCAGCAAG
Primer: GTTCCATTACAGAGTGAGGT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003419
has an Associated Sequence: Sequence Genbank ID: L23906

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
38.030 38.030 38.030
ENSEMBL53 WASHUC2 Chicken Assembly: 3 Chicken
chromosome 3
83427562.000 83427634.000 83427706.000
ENSEMBL71 Galgal4 Chick Assembly: 3 Chicken
chromosome 3
80092256.000 80092328.000 80092400.000


© The Roslin Institute 2007-2012, all rights reserved