This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004621


Marker Name:  ADL0038 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TCGCCTGTGAACTCTTACCC
Primer: AGACATTCTCTAATCATTCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003413
has an Associated Sequence: Local Sequence ID: ARKFSQ00003414
has an Associated Sequence: Sequence Genbank ID: L23916
has an Associated Sequence: Local Sequence ID: ARKFSQ00003412

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 10 Chicken
chromosome 10
65.000 65.000 65.000
Consensus 2005 (A): 10 Chicken
chromosome 10
54.000 55.000 56.000
East Lansing (M): 10 Chicken
chromosome 10
29.540 29.540 29.540
ENSEMBL53 WASHUC2 Chicken Assembly: 10 Chicken
chromosome 10
8525097.000 8525162.000 8525227.000
ENSEMBL53 WASHUC2 Chicken Assembly: 10 Chicken
chromosome 10
8522180.000 8522245.000 8522310.000
ENSEMBL53 WASHUC2 Chicken Assembly: 10 Chicken
chromosome 10
8522180.000 8523703.500 8525227.000
ENSEMBL71 Galgal4 Chick Assembly: 10 Chicken
chromosome 10
7007934.000 7007999.000 7008064.000
Jennen et al. 2004 (A): 10 Chicken
chromosome 10
55.000 55.000 55.000
Kerje et al. 2003a (A): 10 Chicken
chromosome 10
45.300 45.300 45.300
Kerje, S et al. 2003 (A): 10 Chicken
chromosome 10
45.300 45.300 45.300
Wageningen (A): 10 Chicken
chromosome 10
71.300 71.300 71.300
Wageningen (F): 10 Chicken
chromosome 10
76.800 76.800 76.800
Wageningen (M): 10 Chicken
chromosome 10
65.100 65.100 65.100


© The Roslin Institute 2007-2012, all rights reserved