This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004605


Marker Name:  ADL0022 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GCATCAGAGGAAGAAGGAAA
Primer: GGTCAAGGAAATCATAGAAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L23899
has an Associated Sequence: Local Sequence ID: ARKFSQ00003405

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Ben-Avraham, D. et al 2006 (M): Z Chicken
chromosome Z
23.830 23.830 23.830
Consensus 2000 (A): Z Chicken
chromosome Z
0.000 0.000 0.000
Consensus 2005 (A): Z Chicken
chromosome Z
-1.000 0.000 1.000
East Lansing (M): Z Chicken
chromosome Z
23.830 23.830 23.830
ENSEMBL53 WASHUC2 Chicken Assembly: Z Chicken
chromosome Z
4255268.000 4255340.500 4255413.000
ENSEMBL71 Galgal4 Chick Assembly: Z Chicken
chromosome Z
4482665.000 4482737.500 4482810.000
Jacobsson et al 2004 (A): Z Chicken
chromosome Z
0.000 0.000 0.000
Wageningen (A): Z Chicken
chromosome Z
0.000 0.000 0.000
Wageningen (M): Z Chicken
chromosome Z
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved