This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004603


Marker Name:  ADL0020 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: TAGATAAAAATCCTTCCCTT
Primer: GCACTCAAAAGAAAACAAAT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003403
has an Associated Sequence: Sequence Genbank ID: L23888

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
299.010 299.010 299.010
East Lansing (M): 1 Chicken
chromosome 1
274.030 274.030 274.030
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
94157976.000 94158025.000 94158074.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
90293959.000 90294008.000 90294057.000


© The Roslin Institute 2007-2012, all rights reserved