This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004602


Marker Name:  ADL0019 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TGCTGCCTAGACCAGTTCAA
Primer: TCTGCTGGGATTATGTGTCA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003402
has an Associated Sequence: Sequence Genbank ID: L23887

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Carlborg, Orjan. et al . 2003 (A): 1 Chicken
chromosome 1
91.300 91.300 91.300
Compton (F): 1 Chicken
chromosome 1
72.400 72.400 72.400
Consensus 2000 (A): 1 Chicken
chromosome 1
122.000 122.000 122.000
Consensus 2005 (A): 1 Chicken
chromosome 1
121.000 122.000 123.000
East Lansing (M): 1 Chicken
chromosome 1
116.820 116.820 116.820
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
42474406.000 42474457.500 42474509.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
40511180.000 40511231.500 40511283.000
Kerje et al. 2003a (A): 1 Chicken
chromosome 1
91.300 91.300 91.300
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
91.300 91.300 91.300
Wageningen (A): 1 Chicken
chromosome 1
88.200 88.200 88.200
Wageningen (F): 1 Chicken
chromosome 1
79.100 79.100 79.100
Wageningen (M): 1 Chicken
chromosome 1
95.500 95.500 95.500


© The Roslin Institute 2007-2012, all rights reserved