This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004572


Marker Name:  ABL1 
Species:  Chicken
Marker Type:  OTHER-PCR-TYPES
Publication ID: 7910177

PCR Primers

Primer: GAGGACACCATGGAGGTGGA
Primer: GTGGATGAAGAAGTTCTTCTTCTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M14752

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 17 Chicken
chromosome 17
22.000 22.000 22.000
East Lansing (M): 17 Chicken
chromosome 17
31.790 31.790 31.790


© The Roslin Institute 2007-2012, all rights reserved