This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004217


Marker Name:  UBC 
Species:  Pig
Marker Type:  OTHER-PCR-TYPES
Publication ID: 7749223

PCR Primers

Primer: GGCGCACCCTGTCTGACTACA
Primer: TAGAAACCTCCCCTCAAGCGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009162
has an Associated Sequence: Sequence Genbank ID: M18159
has an Associated Sequence: Local Sequence ID: ARKFSQ00009157
has an Associated Sequence: Local Sequence ID: ARKFSQ00009161
has an Associated Sequence: Local Sequence ID: ARKFSQ00009160
has an Associated Sequence: Local Sequence ID: ARKFSQ00009163
has an Associated Sequence: Local Sequence ID: ARKFSQ00009158
has an Associated Sequence: Local Sequence ID: ARKFSQ00009159

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
28586954.000 28586991.500 28587029.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
28586954.000 28587105.500 28587257.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
28586954.000 28587219.500 28587485.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
28586954.000 28587333.500 28587713.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
28586954.000 28587447.500 28587941.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
28586954.000 28587561.500 28588169.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
28586954.000 28587675.500 28588397.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
28259922.000 28260643.500 28261365.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
28260150.000 28260757.500 28261365.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
28260378.000 28260871.500 28261365.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
28260606.000 28260985.500 28261365.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
28260834.000 28261099.500 28261365.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
28261062.000 28261213.500 28261365.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
28261290.000 28261327.500 28261365.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
29960020.000 29960741.500 29961463.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
29960248.000 29960855.500 29961463.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
29960476.000 29960969.500 29961463.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
29960704.000 29961083.500 29961463.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
29960932.000 29961197.500 29961463.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
29961160.000 29961311.500 29961463.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
29961388.000 29961425.500 29961463.000
Fontanesi, L et al 2003 (A): 14 Pig
chromosome 14
49.300 49.300 49.300
PiGMaP SSC14 v1.5 (A): 14 Pig
chromosome 14
84.100 84.100 84.100
PiGMaP SSC14 v1.5 (F): 14 Pig
chromosome 14
78.900 78.900 78.900
PiGMaP SSC14 v1.5 (M): 14 Pig
chromosome 14
89.000 89.000 89.000
PiGMaP v1 (A): 14 Pig
chromosome 14
48.000 48.000 48.000
PiGMaP v1 (F): 14 Pig
chromosome 14
38.000 38.000 38.000
PiGMaP v1 (M): 14 Pig
chromosome 14
59.000 59.000 59.000


© The Roslin Institute 2007-2012, all rights reserved