This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004069


Marker Name:  Sj055 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 11167524

PCR Primers

Primer: CGTAATTATATGATTGGCTTCAC
Primer: GAATTCATTTCCAGAAATCCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009143
has an Associated Sequence: Local Sequence ID: ARKFSQ00009144

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
23888030.000 23888104.000 23888178.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
23671194.000 23671262.000 23671330.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
22531366.000 22531440.000 22531514.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
22744666.000 22744734.000 22744802.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
24310727.000 24310801.000 24310875.000
NIAI-Japan QTL v2 (A): 14 Pig
chromosome 14
28.000 28.000 28.000


© The Roslin Institute 2007-2012, all rights reserved