This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004051


Marker Name:  Sj001 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 11167524

PCR Primers

Primer: CCCAGATGCCAAGATTTCC
Primer: TATTTACAACAGCCAAGACAGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009131

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
25216018.000 25217858.500 25219699.000
ENSEMBL56 Sscrofa9 Pig Assembly: 11 Pig
chromosome 11
18974271.000 18974342.500 18974414.000
NIAI-Japan QTL v2 (A): 11 Pig
chromosome 11
36.400 36.400 36.400
NIAI-Japan v1 (A): 11 Pig
chromosome 11
28.800 28.800 28.800
NIAI-Japan v1 (F): 11 Pig
chromosome 11
22.000 22.000 22.000
NIAI-Japan v1 (M): 11 Pig
chromosome 11
37.300 37.300 37.300


© The Roslin Institute 2007-2012, all rights reserved