This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004022


Marker Name:  SWR925 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: AGCTCCAATTTGACCCCAG
Primer: CTCCAAATTTCTTTGCTCAAGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009111

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
111303509.000 111303572.500 111303636.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
111209061.000 111209124.500 111209188.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
110291266.000 110291329.500 110291393.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
114757839.000 114757902.500 114757966.000
NIAI-Japan QTL v2 (A): 14 Pig
chromosome 14
90.000 90.000 90.000
NIAI-Japan v1 (A): 14 Pig
chromosome 14
87.700 87.700 87.700
NIAI-Japan v1 (F): 14 Pig
chromosome 14
102.300 102.300 102.300
NIAI-Japan v1 (M): 14 Pig
chromosome 14
73.800 73.800 73.800
USDA-MARC v1 (A): 14 Pig
chromosome 14
65.900 65.900 65.900
USDA-MARC v2 (A): 14 Pig
chromosome 14
56.900 56.900 56.900


© The Roslin Institute 2007-2012, all rights reserved