This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004010


Marker Name:  SWR741 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TGCATTCTGTGTTTTTTTTTGA
Primer: GTGCCTGTGGCGTAGACC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009103

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 8 Pig
chromosome 8
8089184.000 8089255.500 8089327.000
ENSEMBL56 Sscrofa9 Pig Assembly: 8 Pig
chromosome 8
12174434.000 12174505.500 12174577.000
ENSEMBL67 Ssc10.2 Pig Assembly: 8 Pig
chromosome 8
15538000.000 15538071.500 15538143.000
NIAI-Japan QTL v2 (A): 8 Pig
chromosome 8
29.100 29.100 29.100
NIAI-Japan v1 (A): 8 Pig
chromosome 8
29.100 29.100 29.100
NIAI-Japan v1 (F): 8 Pig
chromosome 8
32.600 32.600 32.600
NIAI-Japan v1 (M): 8 Pig
chromosome 8
23.000 23.000 23.000
USDA-MARC v1 (A): 8 Pig
chromosome 8
23.200 23.200 23.200
USDA-MARC v2 (A): 8 Pig
chromosome 8
27.000 27.000 27.000


© The Roslin Institute 2007-2012, all rights reserved