This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004003


Marker Name:  SWR493 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: ATATTTAACCCATTGCAGCATG
Primer: CTGCAGCTCCACTTAGACCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009095

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 10 Pig
chromosome 10
37091672.000 37091752.000 37091832.000
ENSEMBL56 Sscrofa9 Pig Assembly: 10 Pig
chromosome 10
45247404.000 45247484.000 45247564.000
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
52173675.000 52173755.000 52173835.000
USDA-MARC v1 (A): 10 Pig
chromosome 10
96.500 96.500 96.500
USDA-MARC v2 (A): 10 Pig
chromosome 10
86.300 86.300 86.300


© The Roslin Institute 2007-2012, all rights reserved