This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003999


Marker Name:  SWR428 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TTCCACGTAGATTTTTGACACG
Primer: ACCTGCGTCCTCATGGATAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009092

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
9121254.000 9121311.000 9121368.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
9712327.000 9712384.000 9712441.000
ENSEMBL67 Ssc10.2 Pig Assembly: 13 Pig
chromosome 13
13078106.000 13078163.000 13078220.000
Jann et al. 2009: 13 Pig
chromosome 13
205.700 205.700 205.700
NIAI-Japan QTL v2 (A): 13 Pig
chromosome 13
16.200 16.200 16.200
NIAI-Japan v1 (A): 13 Pig
chromosome 13
14.800 14.800 14.800
NIAI-Japan v1 (F): 13 Pig
chromosome 13
18.500 18.500 18.500
NIAI-Japan v1 (M): 13 Pig
chromosome 13
11.700 11.700 11.700
Nordic v2 (A): 13 Pig
chromosome 13
24.500 24.500 24.500
Nordic v2 (F): 13 Pig
chromosome 13
22.400 22.400 22.400
Nordic v2 (M): 13 Pig
chromosome 13
27.100 27.100 27.100
USDA-MARC v2 (A): 13 Pig
chromosome 13
22.600 22.600 22.600


© The Roslin Institute 2007-2012, all rights reserved