This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003992


Marker Name:  SWR345 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: AACAGCTCCGATTCAACCC
Primer: TACTCAGCCTTAAAAGGAAGGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009087

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
36835304.000 36837080.000 36838856.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 18 Pig
chromosome 18
36112353.000 36113560.500 36114768.000
ENSEMBL56 Sscrofa9 Pig Assembly: 3 Pig
chromosome 3
3846812.000 3850699.500 3854587.000
NIAI-Japan QTL v2 (A): 2 Pig
chromosome 2
141.400 141.400 141.400
NIAI-Japan v1 (A): 2 Pig
chromosome 2
132.800 132.800 132.800
NIAI-Japan v1 (F): 2 Pig
chromosome 2
170.000 170.000 170.000
NIAI-Japan v1 (M): 2 Pig
chromosome 2
96.300 96.300 96.300
USDA-MARC v2 (A): 2 Pig
chromosome 2
114.400 114.400 114.400


© The Roslin Institute 2007-2012, all rights reserved