This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003971


Marker Name:  SWR2149 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TAACCTGCTGAGCCACAATG
Primer: TTTTGGGGGGTTAAAAGTCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009070
has an Associated Sequence: Local Sequence ID: ARKFSQ00009071

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 6 Pig
chromosome 6
9124586.000 9124673.500 9124761.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 6 Pig
chromosome 6
9124586.000 9128830.000 9133074.000
ENSEMBL56 Sscrofa9 Pig Assembly: 6 Pig
chromosome 6
14921176.000 14925420.000 14929664.000
ENSEMBL56 Sscrofa9 Pig Assembly: 6 Pig
chromosome 6
14929489.000 14929576.500 14929664.000
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
66274855.000 66275012.000 66275169.000
USDA-MARC v2 (A): 6 Pig
chromosome 6
49.100 49.100 49.100


© The Roslin Institute 2007-2012, all rights reserved