This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003959


Marker Name:  SWR201 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TGGAAACACTCTGGCATAACC
Primer: CTCCAACTCAGCCCCTAGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009061
has an Associated Sequence: Local Sequence ID: ARKFSQ00009060

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 3 Pig
chromosome 3
71079608.000 71079669.000 71079730.000
ENSEMBL56 Sscrofa9 Pig Assembly: 3 Pig
chromosome 3
105027087.000 105027148.000 105027209.000
ENSEMBL56 Sscrofa9 Pig Assembly: 3 Pig
chromosome 3
105148741.000 105148802.000 105148863.000
USDA-MARC v1 (A): 3 Pig
chromosome 3
114.700 114.700 114.700
USDA-MARC v2 (A): 3 Pig
chromosome 3
90.600 90.600 90.600


© The Roslin Institute 2007-2012, all rights reserved