This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003957


Marker Name:  SWR198 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TTTCATCAGCAACTTCAGAAGG
Primer: GGTGCGGCCCTAAAAAAAAG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
34108676.000 34108722.000 34108768.000
NIAI-Japan QTL v2 (A): 10 Pig
chromosome 10
69.100 69.100 69.100
NIAI-Japan v1 (A): 10 Pig
chromosome 10
66.800 66.800 66.800
NIAI-Japan v1 (F): 10 Pig
chromosome 10
86.400 86.400 86.400
NIAI-Japan v1 (M): 10 Pig
chromosome 10
57.800 57.800 57.800
USDA-MARC v1 (A): 10 Pig
chromosome 10
78.100 78.100 78.100
USDA-MARC v2 (A): 10 Pig
chromosome 10
65.100 65.100 65.100


© The Roslin Institute 2007-2012, all rights reserved