This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003947


Marker Name:  SWR1849 
Species:  Pig
Marker Type:  PCR-STS
Publication ID: 8743988

PCR Primers

Primer: CCTGTTCTGCCTCTAGCCTG
Primer: CTGAGAAGCCTGTGCATCAG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
34108637.000 34108708.000 34108779.000
USDA-MARC v2 (A): 10 Pig
chromosome 10
65.100 65.100 65.100


© The Roslin Institute 2007-2012, all rights reserved