This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003937


Marker Name:  SWR1634 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TTAGACCCCTAGCCTAGGAACC
Primer: TTACTTGCTGCACCATAAGGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009044

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
11908632.000 11908725.500 11908819.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
13631334.000 13631427.500 13631521.000
USDA-MARC v2 (A): 6 Pig
chromosome 6
76.500 76.500 76.500


© The Roslin Institute 2007-2012, all rights reserved