This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003935


Marker Name:  SWR158 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TCCAATTCAACTCCTGGCTC
Primer: GAATGTGCACATACCACATGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009042

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 10 Pig
chromosome 10
28357301.000 28357383.500 28357466.000
ENSEMBL56 Sscrofa9 Pig Assembly: 10 Pig
chromosome 10
34670987.000 34671069.500 34671152.000
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
40485166.000 40485248.500 40485331.000
USDA-MARC v1 (A): 10 Pig
chromosome 10
75.100 75.100 75.100
USDA-MARC v2 (A): 10 Pig
chromosome 10
67.500 67.500 67.500


© The Roslin Institute 2007-2012, all rights reserved