This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003911


Marker Name:  SWR1133 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TGGGATTTGTTACCACTGAGC
Primer: TCCATGGGTGAAAAAAAGATG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009021

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
12204191.000 12204257.500 12204324.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
13927724.000 13927790.500 13927857.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
15899143.000 15899209.500 15899276.000
NIAI-Japan QTL v2 (A): 17 Pig
chromosome 17
11.000 11.000 11.000
NIAI-Japan v1 (A): 17 Pig
chromosome 17
12.300 12.300 12.300
NIAI-Japan v1 (F): 17 Pig
chromosome 17
18.300 18.300 18.300
NIAI-Japan v1 (M): 17 Pig
chromosome 17
5.700 5.700 5.700
USDA-MARC current (A): 17 Pig
chromosome 17
30.400 30.400 30.400
USDA-MARC v2 (A): 17 Pig
chromosome 17
30.400 30.400 30.400


© The Roslin Institute 2007-2012, all rights reserved