This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003896


Marker Name:  SWR1008 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: ACAGCCACCAACAGTGTTTG
Primer: GAACTTCCATATGCTGCAAGTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009009

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
42005641.000 42005765.000 42005889.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
45211517.000 45211641.000 45211765.000
NIAI-Japan QTL v2 (A): 13 Pig
chromosome 13
59.600 59.600 59.600
NIAI-Japan v1 (A): 13 Pig
chromosome 13
52.100 52.100 52.100
NIAI-Japan v1 (F): 13 Pig
chromosome 13
66.500 66.500 66.500
NIAI-Japan v1 (M): 13 Pig
chromosome 13
39.100 39.100 39.100
USDA-MARC v2 (A): 13 Pig
chromosome 13
53.000 53.000 53.000


© The Roslin Institute 2007-2012, all rights reserved