This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003895


Marker Name:  SWR1004 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TGGGAACACCTGCTTCATTC
Primer: TCCATATGCCCCAAGTGTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009008

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
5762241.000 5762319.000 5762397.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
7066152.000 7066230.000 7066308.000
USDA-MARC current (A): 17 Pig
chromosome 17
17.800 17.800 17.800
USDA-MARC v1 (A): 17 Pig
chromosome 17
17.000 17.000 17.000
USDA-MARC v2 (A): 17 Pig
chromosome 17
17.800 17.800 17.800


© The Roslin Institute 2007-2012, all rights reserved