This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003833


Marker Name:  SW902 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: ATCAGTTGGAAATGATGGCC
Primer: CTTGCCTCAAAGAGTTGTAAGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
NIAI-Japan QTL v2 (A): 3 Pig
chromosome 3
89.200 89.200 89.200
NIAI-Japan v1 (A): 3 Pig
chromosome 3
80.900 80.900 80.900
NIAI-Japan v1 (F): 3 Pig
chromosome 3
100.800 100.800 100.800
NIAI-Japan v1 (M): 3 Pig
chromosome 3
65.800 65.800 65.800
PiGMaP SSC3 v1.5 (A): 3 Pig
chromosome 3
64.000 64.000 64.000
PiGMaP SSC3 v1.5 (F): 3 Pig
chromosome 3
84.000 84.000 84.000
PiGMaP SSC3 v1.5 (M): 3 Pig
chromosome 3
45.000 45.000 45.000
USDA-MARC v1 (A): 3 Pig
chromosome 3
66.700 66.700 66.700
USDA-MARC v2 (A): 3 Pig
chromosome 3
58.400 58.400 58.400


© The Roslin Institute 2007-2012, all rights reserved