This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003824


Marker Name:  SW864 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TTGCACAGATGCTAATTCTTCC
Primer: TTAAGACTGTCTTGGGCATTCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008970

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
24376482.000 24376565.500 24376649.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
26429450.000 26429533.500 26429617.000
ENSEMBL67 Ssc10.2 Pig Assembly: 13 Pig
chromosome 13
34673522.000 34673605.500 34673689.000
Jann et al. 2009: 13 Pig
chromosome 13
514.000 514.000 514.000
NIAI-Japan QTL v2 (A): 13 Pig
chromosome 13
44.900 44.900 44.900
NIAI-Japan v1 (A): 13 Pig
chromosome 13
39.400 39.400 39.400
NIAI-Japan v1 (F): 13 Pig
chromosome 13
52.200 52.200 52.200
NIAI-Japan v1 (M): 13 Pig
chromosome 13
28.200 28.200 28.200
USDA-MARC v2 (A): 13 Pig
chromosome 13
43.100 43.100 43.100
Zhang, Jingu et al 2007 (A): 13 Pig
chromosome 13
69.900 69.900 69.900
Zhang, Jingu et al 2007 (F): 13 Pig
chromosome 13
52.500 52.500 52.500
Zhang, Jingu et al 2007 (M): 13 Pig
chromosome 13
67.900 67.900 67.900


© The Roslin Institute 2007-2012, all rights reserved