This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003811


Marker Name:  SW836 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TCCAGTGACAATGTCAGGTTC
Primer: TTAGTCACTCTTTTGGAGCCTC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL67 Ssc10.2 Pig Assembly: 3 Pig
chromosome 3
63760640.000 63760710.500 63760781.000
USDA-MARC v1 (A): 3 Pig
chromosome 3
73.100 73.100 73.100
USDA-MARC v2 (A): 3 Pig
chromosome 3
60.500 60.500 60.500


© The Roslin Institute 2007-2012, all rights reserved