This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003786


Marker Name:  SW77 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: ATCAGACCGAGGGTTGCC
Primer: GAAATCTGCATGGTCTCAAGTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008940

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
129649044.000 129649103.000 129649162.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
129035790.000 129035849.000 129035908.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
134456199.000 134456258.000 134456317.000
NIAI-Japan QTL v2 (A): 14 Pig
chromosome 14
112.100 112.100 112.100
NIAI-Japan v1 (A): 14 Pig
chromosome 14
105.800 105.800 105.800
NIAI-Japan v1 (F): 14 Pig
chromosome 14
121.300 121.300 121.300
NIAI-Japan v1 (M): 14 Pig
chromosome 14
91.300 91.300 91.300
USDA-MARC v1 (A): 14 Pig
chromosome 14
47.900 47.900 47.900
USDA-MARC v2 (A): 14 Pig
chromosome 14
69.400 69.400 69.400


© The Roslin Institute 2007-2012, all rights reserved