This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003785


Marker Name:  SW769 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: GGTATGACCAAAAGTCCTGGG
Primer: TCTGCTATGTGGGAAGAATGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008939

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
132914932.000 132914984.500 132915037.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
142452081.000 142452133.500 142452186.000
ENSEMBL67 Ssc10.2 Pig Assembly: 13 Pig
chromosome 13
212032298.000 212032350.500 212032403.000
Jann et al. 2009: 13 Pig
chromosome 13
2566.900 2566.900 2566.900
NIAI-Japan QTL v2 (A): 13 Pig
chromosome 13
145.500 145.500 145.500
NIAI-Japan v1 (A): 13 Pig
chromosome 13
127.500 127.500 127.500
NIAI-Japan v1 (F): 13 Pig
chromosome 13
142.800 142.800 142.800
NIAI-Japan v1 (M): 13 Pig
chromosome 13
121.900 121.900 121.900
USDA-MARC v2 (A): 13 Pig
chromosome 13
117.500 117.500 117.500


© The Roslin Institute 2007-2012, all rights reserved