This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003784


Marker Name:  SW767 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TGCGTGACTAGAACCCTGTG
Primer: TCACGCAGAACGTTTCAGAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008937
has an Associated Sequence: Local Sequence ID: ARKFSQ00008938

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 10 Pig
chromosome 10
8178449.000 8178512.500 8178576.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 10 Pig
chromosome 10
8069957.000 8070020.500 8070084.000
ENSEMBL56 Sscrofa9 Pig Assembly: 10 Pig
chromosome 10
8936590.000 8936653.500 8936717.000
ENSEMBL56 Sscrofa9 Pig Assembly: 10 Pig
chromosome 10
9062294.000 9062357.500 9062421.000
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
11046155.000 11046218.500 11046282.000
USDA-MARC v1 (A): 10 Pig
chromosome 10
16.500 16.500 16.500
USDA-MARC v2 (A): 10 Pig
chromosome 10
20.400 20.400 20.400


© The Roslin Institute 2007-2012, all rights reserved