This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003767


Marker Name:  SW72 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: ATCAGAACAGTGCGCCGT
Primer: TTTGAAAATGGGGTGTTTCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008926
has an Associated Sequence: Local Sequence ID: ARKFSQ00008925

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 3 Pig
chromosome 3
6426947.000 6427002.500 6427058.000
ENSEMBL56 Sscrofa9 Pig Assembly: 3 Pig
chromosome 3
12674644.000 12674699.500 12674755.000
ENSEMBL56 Sscrofa9 Pig Assembly: 3 Pig
chromosome 3
12924292.000 12924347.500 12924403.000
ENSEMBL67 Ssc10.2 Pig Assembly: 3 Pig
chromosome 3
14776389.000 14776444.500 14776500.000
NIAI-Japan QTL v2 (A): 3 Pig
chromosome 3
40.900 40.900 40.900
NIAI-Japan v1 (A): 3 Pig
chromosome 3
36.800 36.800 36.800
NIAI-Japan v1 (F): 3 Pig
chromosome 3
37.300 37.300 37.300
NIAI-Japan v1 (M): 3 Pig
chromosome 3
39.000 39.000 39.000
Nordic v2 (A): 3 Pig
chromosome 3
39.500 39.500 39.500
Nordic v2 (F): 3 Pig
chromosome 3
44.100 44.100 44.100
Nordic v2 (M): 3 Pig
chromosome 3
32.700 32.700 32.700
PiGMaP SSC3 v1.5 (A): 3 Pig
chromosome 3
40.000 40.000 40.000
PiGMaP SSC3 v1.5 (F): 3 Pig
chromosome 3
63.000 63.000 63.000
PiGMaP SSC3 v1.5 (M): 3 Pig
chromosome 3
15.000 15.000 15.000
USDA-MARC v1 (A): 3 Pig
chromosome 3
23.300 23.300 23.300
USDA-MARC v2 (A): 3 Pig
chromosome 3
17.800 17.800 17.800


© The Roslin Institute 2007-2012, all rights reserved