This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003758


Marker Name:  SW7 
Species:  Pig
Marker Type:  OTHER-PCR-TYPES
Publication ID: 8138161

PCR Primers

Primer: TAACCATGCTTTTCCTAGGTGG
Primer: CCAGAGCTGAGTAAAAAGGTCA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008915

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL56 Sscrofa9 Pig Assembly: 8 Pig
chromosome 8
27776652.000 27776706.000 27776760.000
ENSEMBL67 Ssc10.2 Pig Assembly: 8 Pig
chromosome 8
34473703.000 34473757.000 34473811.000
Jann et al. 2009: 8 Pig
chromosome 8
551.000 551.000 551.000
NIAI-Japan QTL v2 (A): 8 Pig
chromosome 8
53.600 53.600 53.600
NIAI-Japan v1 (A): 8 Pig
chromosome 8
53.600 53.600 53.600
NIAI-Japan v1 (F): 8 Pig
chromosome 8
59.800 59.800 59.800
NIAI-Japan v1 (M): 8 Pig
chromosome 8
47.300 47.300 47.300
USDA-MARC v1 (A): 8 Pig
chromosome 8
57.600 57.600 57.600
USDA-MARC v2 (A): 8 Pig
chromosome 8
55.400 55.400 55.400


© The Roslin Institute 2007-2012, all rights reserved