This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003754


Marker Name:  SW698 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: ATACAAACCATAGCCATGGACC
Primer: GATCCGATTTCAGGCCTTAA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008914

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
117745771.000 117745875.000 117745979.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
126724508.000 126724612.000 126724716.000
ENSEMBL67 Ssc10.2 Pig Assembly: 13 Pig
chromosome 13
186521009.000 186521113.000 186521217.000
NIAI-Japan QTL v2 (A): 13 Pig
chromosome 13
103.600 103.600 103.600
NIAI-Japan v1 (A): 13 Pig
chromosome 13
86.400 86.400 86.400
NIAI-Japan v1 (F): 13 Pig
chromosome 13
98.500 98.500 98.500
NIAI-Japan v1 (M): 13 Pig
chromosome 13
75.600 75.600 75.600
USDA-MARC v2 (A): 13 Pig
chromosome 13
71.700 71.700 71.700


© The Roslin Institute 2007-2012, all rights reserved