This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003753


Marker Name:  SW69 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TCAGCTTCGTGAACAAGGG
Primer: ACCTCCCTCATCAGCTATTCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008913

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
58426016.000 58426090.000 58426164.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
57793806.000 57793880.000 57793954.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
60644503.000 60644577.000 60644651.000
NIAI-Japan QTL v2 (A): 14 Pig
chromosome 14
51.300 51.300 51.300
NIAI-Japan v1 (A): 14 Pig
chromosome 14
48.200 48.200 48.200
NIAI-Japan v1 (F): 14 Pig
chromosome 14
57.000 57.000 57.000
NIAI-Japan v1 (M): 14 Pig
chromosome 14
41.500 41.500 41.500
USDA-MARC v1 (A): 14 Pig
chromosome 14
85.200 85.200 85.200
USDA-MARC v2 (A): 14 Pig
chromosome 14
41.500 41.500 41.500


© The Roslin Institute 2007-2012, all rights reserved