This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003724


Marker Name:  SW540 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TCAGTGGAGGGCGAATAAAC
Primer: CCAAATCCTGGCAACACAG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008893

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
28267551.000 28267676.500 28267802.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
27950577.000 27950702.500 27950828.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
29711233.000 29711358.500 29711484.000
NIAI-Japan QTL v2 (A): 14 Pig
chromosome 14
36.700 36.700 36.700
NIAI-Japan v1 (A): 14 Pig
chromosome 14
34.200 34.200 34.200
NIAI-Japan v1 (F): 14 Pig
chromosome 14
38.700 38.700 38.700
NIAI-Japan v1 (M): 14 Pig
chromosome 14
31.100 31.100 31.100
USDA-MARC v1 (A): 14 Pig
chromosome 14
98.100 98.100 98.100
USDA-MARC v2 (A): 14 Pig
chromosome 14
31.500 31.500 31.500


© The Roslin Institute 2007-2012, all rights reserved