This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003719


Marker Name:  SW520 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: GCCACCGGTGTGACTCTAAA
Primer: CTTTTCCCAAGTTCACTTAGCA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008888

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
121563537.000 121563594.500 121563652.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
130987385.000 130987442.500 130987500.000
ENSEMBL67 Ssc10.2 Pig Assembly: 13 Pig
chromosome 13
192233281.000 192233338.500 192233396.000
NIAI-Japan QTL v2 (A): 13 Pig
chromosome 13
114.600 114.600 114.600
NIAI-Japan v1 (A): 13 Pig
chromosome 13
96.500 96.500 96.500
NIAI-Japan v1 (F): 13 Pig
chromosome 13
111.300 111.300 111.300
NIAI-Japan v1 (M): 13 Pig
chromosome 13
83.300 83.300 83.300
USDA-MARC v2 (A): 13 Pig
chromosome 13
74.400 74.400 74.400
Zhang, Jingu et al 2007 (A): 13 Pig
chromosome 13
123.400 123.400 123.400
Zhang, Jingu et al 2007 (F): 13 Pig
chromosome 13
99.900 99.900 99.900
Zhang, Jingu et al 2007 (M): 13 Pig
chromosome 13
133.600 133.600 133.600


© The Roslin Institute 2007-2012, all rights reserved