This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003709


Marker Name:  SW487 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TGAGCACCTCTGCTTGAGTC
Primer: ACACCTCTAAAATGGCAGTGTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008880

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 3 Pig
chromosome 3
13691412.000 13691506.500 13691601.000
ENSEMBL56 Sscrofa9 Pig Assembly: 3 Pig
chromosome 3
27336705.000 27336799.500 27336894.000
ENSEMBL67 Ssc10.2 Pig Assembly: 3 Pig
chromosome 3
31261211.000 31261305.500 31261400.000
NIAI-Japan QTL v2 (A): 3 Pig
chromosome 3
73.900 73.900 73.900
NIAI-Japan v1 (A): 3 Pig
chromosome 3
65.900 65.900 65.900
NIAI-Japan v1 (F): 3 Pig
chromosome 3
84.000 84.000 84.000
NIAI-Japan v1 (M): 3 Pig
chromosome 3
52.500 52.500 52.500
USDA-MARC v1 (A): 3 Pig
chromosome 3
54.300 54.300 54.300
USDA-MARC v2 (A): 3 Pig
chromosome 3
46.000 46.000 46.000


© The Roslin Institute 2007-2012, all rights reserved