This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003699


Marker Name:  SW452 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: ACAGGAAAGTGACCCTGCC
Primer: TGGAACATGATGGAGGATAATG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008875

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
21164998.000 21165044.500 21165091.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
22748688.000 22748734.500 22748781.000
NIAI-Japan QTL v2 (A): 13 Pig
chromosome 13
38.800 38.800 38.800
NIAI-Japan v1 (A): 13 Pig
chromosome 13
34.100 34.100 34.100
NIAI-Japan v1 (F): 13 Pig
chromosome 13
46.500 46.500 46.500
NIAI-Japan v1 (M): 13 Pig
chromosome 13
24.700 24.700 24.700
USDA-MARC v2 (A): 13 Pig
chromosome 13
36.900 36.900 36.900


© The Roslin Institute 2007-2012, all rights reserved