This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003692


Marker Name:  SW444 
Species:  Pig
Marker Type:  OTHER-PCR-TYPES
Publication ID: 8138161

PCR Primers

Primer: ATAGTTTCGGTTGGCCCAG
Primer: CTTAAGCCTCAAGCTAACAGGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008872

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 8 Pig
chromosome 8
19700352.000 19700416.500 19700481.000
ENSEMBL56 Sscrofa9 Pig Assembly: 8 Pig
chromosome 8
26866755.000 26866819.500 26866884.000
ENSEMBL67 Ssc10.2 Pig Assembly: 8 Pig
chromosome 8
33001520.000 33001584.500 33001649.000
Jann et al. 2009: 8 Pig
chromosome 8
508.500 508.500 508.500
NIAI-Japan QTL v2 (A): 8 Pig
chromosome 8
50.100 50.100 50.100
NIAI-Japan v1 (A): 8 Pig
chromosome 8
50.100 50.100 50.100
NIAI-Japan v1 (F): 8 Pig
chromosome 8
54.900 54.900 54.900
NIAI-Japan v1 (M): 8 Pig
chromosome 8
45.100 45.100 45.100
USDA-MARC v1 (A): 8 Pig
chromosome 8
54.100 54.100 54.100
USDA-MARC v2 (A): 8 Pig
chromosome 8
52.500 52.500 52.500


© The Roslin Institute 2007-2012, all rights reserved