This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003663


Marker Name:  SW353 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: CACCCCATGCCTGAATACTG
Primer: ATGTGAAGACTCATGCTTGGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008855

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL56 Sscrofa9 Pig Assembly: 6 Pig
chromosome 6
76904990.000 76905060.500 76905131.000
ENSEMBL67 Ssc10.2 Pig Assembly: 6 Pig
chromosome 6
104254876.000 104254946.500 104255017.000
Intl Wrkshp.1 (A): 6 Pig
chromosome 6
141.800 141.800 141.800
Intl Wrkshp.1 (F): 6 Pig
chromosome 6
174.600 174.600 174.600
Intl Wrkshp.1 (M): 6 Pig
chromosome 6
108.000 108.000 108.000
Nordic v2 (A): 6 Pig
chromosome 6
116.800 116.800 116.800
Nordic v2 (F): 6 Pig
chromosome 6
143.400 143.400 143.400
Nordic v2 (M): 6 Pig
chromosome 6
93.300 93.300 93.300
USDA-BARC.6 (A): 6 Pig
chromosome 6
84.200 84.200 84.200
USDA-BARC.6 (F): 6 Pig
chromosome 6
123.800 123.800 123.800
USDA-BARC.6 (M): 6 Pig
chromosome 6
65.600 65.600 65.600
USDA-MARC SSC6 v2.5 (A): 6 Pig
chromosome 6
90.000 90.000 90.000
USDA-MARC SSC6 v2.5 (F): 6 Pig
chromosome 6
109.000 109.000 109.000
USDA-MARC SSC6 v2.5 (M): 6 Pig
chromosome 6
72.100 72.100 72.100
USDA-MARC v1 (A): 6 Pig
chromosome 6
22.500 22.500 22.500
USDA-MARC v2 (A): 6 Pig
chromosome 6
102.500 102.500 102.500


© The Roslin Institute 2007-2012, all rights reserved