This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003660


Marker Name:  SW349 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: CCTGTTGTAGGCTCCATGAG
Primer: CTAGGAGTCGGCCCTGAAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008852

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 3 Pig
chromosome 3
84228660.000 84228735.000 84228810.000
ENSEMBL56 Sscrofa9 Pig Assembly: 3 Pig
chromosome 3
122887214.000 122887289.000 122887364.000
NIAI-Japan QTL v2 (A): 3 Pig
chromosome 3
164.900 164.900 164.900
NIAI-Japan v1 (A): 3 Pig
chromosome 3
144.900 144.900 144.900
NIAI-Japan v1 (F): 3 Pig
chromosome 3
165.700 165.700 165.700
NIAI-Japan v1 (M): 3 Pig
chromosome 3
126.000 126.000 126.000
Nordic v2 (A): 3 Pig
chromosome 3
131.200 131.200 131.200
Nordic v2 (F): 3 Pig
chromosome 3
158.000 158.000 158.000
Nordic v2 (M): 3 Pig
chromosome 3
100.900 100.900 100.900
USDA-MARC v1 (A): 3 Pig
chromosome 3
137.300 137.300 137.300
USDA-MARC v2 (A): 3 Pig
chromosome 3
112.600 112.600 112.600


© The Roslin Institute 2007-2012, all rights reserved