This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003659


Marker Name:  SW344 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: AGCTTCGTGTGTGCAGGAG
Primer: GTAGTGGTCCAAAGAGAGTGCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008851

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
18757040.000 18757119.500 18757199.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
20490506.000 20490585.500 20490665.000
ENSEMBL67 Ssc10.2 Pig Assembly: 13 Pig
chromosome 13
27210688.000 27210767.500 27210847.000
NIAI-Japan QTL v2 (A): 13 Pig
chromosome 13
37.300 37.300 37.300
NIAI-Japan v1 (A): 13 Pig
chromosome 13
31.900 31.900 31.900
NIAI-Japan v1 (F): 13 Pig
chromosome 13
44.100 44.100 44.100
NIAI-Japan v1 (M): 13 Pig
chromosome 13
21.200 21.200 21.200
USDA-MARC v2 (A): 13 Pig
chromosome 13
35.400 35.400 35.400


© The Roslin Institute 2007-2012, all rights reserved