This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003658


Marker Name:  SW342 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: GGGTTCTGTGGTAGTGACTGC
Primer: TCATCCACAACAGCAGAACC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008850

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
99077629.000 99077679.000 99077729.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
98266494.000 98266544.000 98266594.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
102170112.000 102170162.000 102170212.000
NIAI-Japan QTL v2 (A): 14 Pig
chromosome 14
83.600 83.600 83.600
NIAI-Japan v1 (A): 14 Pig
chromosome 14
82.600 82.600 82.600
NIAI-Japan v1 (F): 14 Pig
chromosome 14
94.000 94.000 94.000
NIAI-Japan v1 (M): 14 Pig
chromosome 14
72.100 72.100 72.100
USDA-MARC v1 (A): 14 Pig
chromosome 14
71.700 71.700 71.700
USDA-MARC v2 (A): 14 Pig
chromosome 14
53.200 53.200 53.200


© The Roslin Institute 2007-2012, all rights reserved